Logo-aim
Arch Iran Med. 27(6):305-312. doi: 10.34172/aim.28579

Original Article

Low Prevalence of Anti-HBc Antibody and Lack of HBV DNA Among HBsAg-Negative Blood Donors in Iran: A Cross-sectional Study and Review of Literature

Mohammad Reza Hedayati-Moghaddam Conceptualization, Data curation, Formal analysis, Investigation, Methodology, Writing – original draft, Writing – review & editing, 1 ORCID logo
Farahnaz Tehranian Data curation, Investigation, 2, 3
Arman Mosavat Investigation, 1 ORCID logo
Rahele Miri Investigation, 1
Sanaz Ahmadi Ghezeldasht Data curation, Investigation, Project administration, Writing – original draft, 1, * ORCID logo

Author information:
1Blood Borne Infections Research Center, Academic Center for Education, Culture and Research (ACECR), Razavi Khorasan, Mashhad, Iran
2Blood Transfusion Research Center, High Institute for Research and Education in Transfusion Medicine, Tehran, Iran
3Razavi Khorasan Blood Transfusion Center, Mashhad, Iran

*Corresponding Author: Sanaz Ahmadi Ghezeldasht, Email: snz855951@gmail.com

Abstract

Background:

Occult hepatitis B infection (OBI) refers to the presence of hepatitis B virus (HBV) DNA in the serum or liver of individuals who tested negative for HBV surface antigen (HBsAg). This study aimed to determine seropositivity for antibodies against HBV core antigen (anti-HBc) and the frequency of OBI among the HBsAg non-reactive blood donors in Mashhad, northeastern Iran.

Methods:

In this cross-sectional study, serum samples of HBsAg-negative blood donors were examined for anti-HBc during June and August 2018. Anti-HBc-positive samples were tested for antibodies against HBsAg (anti-HBs), and those with negative results were classified as isolated anti-HBc cases. The presence of HBV DNA in the C, S, and X gene regions was assessed by a qualitative real-time polymerase chain reaction method in all HBsAg-negative samples. OBI subjects were detected by the presence of at least one HBV genomic region.

Results:

Of 540 HBsAg-negative donors, 29 (5.4%; 95% confidence interval: 3.6–7.6%) showed seroreactivity for anti-HBc, of whom 18 individuals were also seropositive for anti-HBs. All donors showed negative results for all three HBV genes regardless of their serum anti-HBc status.

Conclusion:

Based on our findings, we suggest routine screening of Iranian blood donation volunteers for serum anti-HBc and anti-HBs but not HBV DNA.

Keywords: Blood donors, Iran, Occult hepatitis B virus infection, Prevalence

Copyright and License Information

© 2024 The Author(s).
This is an open-access article distributed under the terms of the Creative Commons Attribution License (https://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.

Cite this article as: Hedayati-Moghaddam MR, Tehranian F, Mosavat A, Miri R, Ahmadi Ghezeldasht S. Low prevalence of anti-HBc antibody and lack of HBV DNA among HBsAg-negative blood donors in Iran: a cross-sectional study and review of literature. Arch Iran Med. 2024;27(6):305-312. doi: 10.34172/aim.28579


Introduction

Despite extensive efforts to ensure blood safety, hepatitis B virus (HBV) infection poses a high risk, with a rate of 1 in 63,000 transfused blood units.1 Screening donated blood cannot eliminate the risk of post-transfusion HBV infection due to the pre-seroconversion window period, as well as the presence of occult infection in some blood donors (BDs).2 Occult HBV infection (OBI) refers to the presence of HBV DNA in the serum and/or liver samples without detectable HBV surface antigen (HBsAg) in the serum, along with or without the presence of antibodies against HBV core (anti-HBc) or surface (anti-HBs) antigens.3

The emergence of OBI might be due to mutations in the α-determinant of the HBV S genomic region. Therefore, the commonly used enzyme-linked immunosorbent assay (ELISA) cannot detect the HBsAg in serum samples.4 In 2004, OBI was defined as HBV DNA positivity without HBsAg, with or without HBV antibodies seroreactivity, if the window period is excluded.5 Then, in 2008, a maximum level of 200 IU/mL for serum HBV DNA was introduced for OBI definition and those with HBV DNA > 200 IU/mL were suggested to be considered as false OBI cases.6 The liver cell examination for detection of replication-competence of viral DNA is the ideal method for OBI diagnosis. A molecular approach such as nested polymerase chain reaction (PCR) with amplifying at least three different regions of the HBV genome or real-time PCR assays are advised for OBI assessment. However, diagnosis is often performed using serum HBV DNA due to practical difficulties.7

According to an update provided by a large number of international experts in 2018, testing more than one blood sample and the analysis of DNA extracts from at least one milliliter of serum is suggested for OBI detection.8 Moreover, due to the intermittent pattern of HBV DNA detection in OBI cases alongside its cost limitation, antiHBc testing can be used as an alternative method to screen occult infections and, therefore, to reduce the risk of HBV transmission.9 Nonetheless, it may also lead to excluding an unacceptable proportion of volunteers from blood donation due to false-positive results in areas with high rates of exposure to HBV.10

Several studies have indicated that OBI is more prevalent in areas with high levels of HBV endemicity.11 In a systematic review of 61 studies published between 2000 and 2020 from 25 out of 31 provinces of Iran,12 the pooled rate of HBV infection among BDs was estimated at 0.57% (95% CI: 0.47–0.67%), with marked disparity (0.1–2.34%) across the provinces. The authors concluded that HBV prevalence has shown a declining trend over the past decades, indicating the effectiveness of the blood safety measures taken in the country. On the other hand, very high proportions of anti-HBc reactive donors (8.9–11.0%) were reported from areas of high HBV endemicity in Iran, such as the Golestan and Sistan-Baluchestan provinces.13-15 Moreover, we previously estimated that an average 7.9% of Iranian anti-HBc-positive BDs have molecular evidence of OBI.16 Also, significant OBI rates were estimated among high-risk Iranian populations such as those who inject drugs,17 those with hepatitis C virus or human immunodeficiency virus infections,18 patients with cryptogenic cirrhosis,19 as well as hemodialysis patients.20

We previously reported rates of 1.4% and 0.33% HBsAg positivity among the general population and blood donation volunteers, respectively, in Mashhad, the capital city of Razavi Khorasan province, northeastern Iran.21,22 On the other hand, 8.5% of HBsAg non-reactive BDs in this city showed anti-HBc seroreactivity; however, no cases of occult hepatitis B were detected among anti-HBC-positive BDs.23 We aimed to determine the rate of anti-HBC seropositivity among HbsAg seronegative donors in this region and HBV DNA positivity irrespective of serum anti-HBc status.


Materials and Methods

During June and August 2018, a total of 540 blood samples were obtained from healthy donors who referred to Mashhad blood centers and had negative result tests for serum HBsAg and antibodies against hepatitis C and human immunodeficiency viruses. Routinely, all volunteers were assessed by a trained general practitioner, and those with a history of risky behaviors or medical conditions were excluded from blood donation. The donors with no donation history were considered first-time donors, and those who previously donated blood were defined as repeat donors.

In the Central Lab of ACECR, Razavi Khorasan Branch, Mashhad, Iran, serum anti-HBc IgG was detected using a commercial ELISA kit (DIA.PRO, Italy, with 99.7% sensitivity and 99.5–99.8% specificity) according to the manufacturer’s instructions. Serum anti-HBs was also examined on all anti-HBc-positive samples by ELISA (DIA.PRO, Italy, with 100% sensitivity and 98.8% specificity) according to the manufacturer’s guidelines.

In order to detect the maximum likelihood of OBI, three regions of HBV DNA (S, C, and X genes) were targeted via real-time PCR, SYBR green method (10.1128/JCM.40.11.4068–4071.2002 and 10.1097/01.EPX.0000427065.73965.c8). The viral DNA was extracted from all blood donation samples negative for HBsAg by a commercial kit (QIAamp DSP Virus Spin kit, Germany) regardless of their serum anti-HBc and anti-HBs status. The extracted DNAs were examined for HBV DNA presence using three pairs of specific primers (Table 1). HBV positive control was kindly provided by the Central Medical Diagnostic Lab of the Academic Center for Education, Culture and Research (ACECR), Razavi Khorasan Branch. Real-time PCR amplifications were performed by the RealQ Plus Master Mix Green (AMPLIQON, Denmark) via Rotorgen Q-6000 real-time PCR machine (Qiagen, Germany). The PCR amplification reactions were considered to a final volume of 25 µL, including 1 µL of each primer (10 pmol), 12.5 µL of SYBR Green Master Mix, 10 µL of DNA template, and 0.5 µL of nuclease-free water. PCR amplification for the S gene was done using a two-step PCR program, including one cycle of 95 °C for 15 minutes, then 95 °C for 15 seconds, followed by annealing and extension at 50 °C for 60 seconds, repeated for 45 cycles. Also, the C and X genes were detected as follows: one cycle of 95 °C for 15 minutes, then 95°C for 15 seconds, followed by annealing and extension at 55 °C for 60 seconds, repeated for 40 cycles. Finally, the melting curve analysis profile was 65 °C for 30 seconds and 95 °C for 30 seconds.


Table 1. Primer Sequences of Three Regions of the HBV Genome
HBV Target Gene Sequence (5' → 3') Nucleotide Position References
Surface gene F: AGAACATCGCATCAGGACTC
R: CATAGGTATCTTGCGAAAGC
159–178
642–623
10.1128/JCM.40.11.4068–4071.2002
10.1097/01.EPX.0000427065.73965.c8
Core gene F: CTGGGAGGAGTTGGGGGA
R: GTAGAAGAATAAAGCCC
1730–1747
2503–2487
10.1128/JCM.40.11.4068–4071.2002
10.1097/01.EPX.0000427065.73965.c8
X gene F: CTAGCCGCTTGTTTTGCTCG
R: TTATGCCTACAGCCTCCTAG
1282–1301
1666–1647
10.1128/JCM.40.11.4068–4071.2002
10.1097/01.EPX.0000427065.73965.c8

OBI cases were detected by the presence of at least one HBV genomic region (S/C/X genes). The detection limit was established for each HBV gene threshold (Ct/Cq value), with a positive threshold set at ≤ 38.

Statistical Analysis

Using a single proportion formula, the sample size was determined to estimate the prevalence of OBI among our target population. Based on the findings of a survey conducted in Tehran Blood Transfusion Center,24 the frequency of HBV DNA positivity among anti-HBc-positive specimens was considered as 50% (P = 0.5). Considering a precision of 4% at a 95% confidence level, we estimated that 601 cases would need to be enrolled. Data were analyzed using SPSS Statistics for Windows, version 19 (IBM Corp., Armonk, N.Y., USA). Categorized variables were presented as numbers and percentages and analyzed using chi-Square and, if indicated, Fisher exact tests. Numerical variables were described using mean and standard deviation, and an independent samples t-test was conducted for analysis. Moreover, a binary logistic regression analysis was used to determine potential variables associated with anti-HBc seropositivity in the studied population. A statistical significance level of P < 0.05 was considered.


Results

From 540 HBsAg-negative BDs with a mean age of 38.4 ± 10.3 (range: 18‒62) years, nearly all participants (98.5%) were male, and most (89.6%) were categorized as repeat donors with an average of 9.5 ± 7.8 times of donation.

A total number of 29 samples (5.4%; 95% confidence interval [CI]: 3.6–7.6%) showed seroreactivity for anti-HBc; all were male, most (72.4%) were 40 years or older, and almost all (93.1%) were repeat donors (Table 2). Multivariate analysis showed that anti-HBc seropositivity was significantly related with the participants’ age (P < 0.001). However, the participant’s gender (P = 0.99) or donation status (P = 0.81) were not significantly associated with a positive result for this serology test.


Table 2. Anti-HBc Seropositivity among Blood Donors Based on Their Age, Sex, and Donation
Variable Total, No. (%) Anti-HBc Positive, No. (%) P Value
Sex
Female 8 (1.5%) 0 (0.0%) 1.0
Male 532 (98.5%) 29 (5.5%)
Age
 < 20 8 (1.5%) 0 (0%)  < 0.001
20–29 100 (18.6%) 1 (1.0%)
30–39 221 (41.0%) 7 (3.2%)
40–49 120 (22.3%) 9 (7.5%)
50–59 78 (14.5%) 10 (12.8%)
 ≥ 60 12 (2.2%) 2 (16. 7%)
Donation status
First-time 56 (10.4%) 2 (3.6%) 0.76
Repeat 484 (89.6%) 27 (5.6%)

Of 28 anti-HBc reactive donors, 18 (64.3%; 95% CI: 44.1–81.4%) individuals were also seropositive for anti-HBs, of whom 12 donors (66. 7%) had antibody titers higher than 100 IU/L. Ten (35.7%; 95% CI: 18.6–55.9%) subjects with detectable anti-HBc were seronegative for anti-HBs and classified as anti-HBc only or isolated anti-HBc cases. Neither anti-HBc-positive nor anti-HBc-negative donors showed positive results for the S, C, or X viral genes. In other words, no OBI cases were found among the studied population.

We reviewed surveys on HBsAg, anti-HBc, and HBV DNA positivity among Iranian BDs and summarized the findings in Table 3. HBsAg seroreactivity varied greatly based on the studies date and location; the highest rates were reported from the Golestan (2.2%) and Sistan-Baluchestan (2.3%) provinces in 2005, and rates as low as 0.1% were reported from the Kerman, Golestan, and Fars provinces during 2019‒2022. Regarding anti-HBc, the highest rates were reported from the Sistan-Baluchestan (20.2% in 2010), Tehran (11.5% in 2007), Markazi (11.2% in 2010), and Golestan (11.0% in 2019) provinces (Table 3). The OBI rate indicated a significant disproportionate distribution among Iranian BDs, from zero to 29.8% (one survey with an unexpectedly high frequency (50%) was omitted).


Table 3. Reported Prevalence of HBsAg, Anti-HBc, and HBV DNA among Iranian Blood Donors
Province First Author Year Sample
Size
HbsAg+
(%)
Study Year Sample
Size
Anti-HBc+
(%)
HBV DNA+
(%)
Bushehr Esmaieli25 2009 20 294 0.24
Chaharmahal-Bakhtiari Doosti26 2009 11 200 1.79
Fars Ghavanini 27 2000 7964 1.07 Behzad-Behbahani28 2006 2000 6.55 12.21
Emamghorashi29 2006 3011 0.37 Behzad-Behbahani30 2011 1500 5.07 15.79
Kasraian31 2007 510 030 0.49
Kasraian32 2010 203 761 0.37
Kasraian33 2012 96 909 0.27
Azadbakht34 2020 1 955 162 0.14
Ghazvin Vahid35 2005 39 598 1.08
Golestan Kazeminejad36 2005 39 806 2.23 Tabarasad-Laleh14 2019 3500 11.00 0.00
Bani Aghil37 2010 129 469 0.98 Bahrami13 2022 4313 8.90 0.00
Bahrami13 2022 47 506 0.12
Guilan Mansour Ghanaei38 2008 222 505 0.45 Khamesipour39 2011 2041 3.82 1.28
Taheri Azbarmi40 2008 49 950 0.26
Hamadan Rezazadeh, M. 2006 18 306 0.77
Ranjbarian, P. 2008 8468 0.47
Hormozghan - Khorami41 2013 1000 8.30 -
Isfehan Afzali42 2002 44 004 0.62 Pourazar43 2005 545 7.89 11.63
Moniri44 2004 603 0.50
Masaeli45 2006 29 619 0.54
Pourazar46 2006 51 799 0.67
Ebrahimian47 2011 542 705 0.20
Kerman Arab, M.48 2006 15 535 1.04 Jafarzadeh49 2008 270 5.19 -
Seyed Askari, SM.50 2015 361 559 0.23 Kazemi Arababadi51 2009 3700 9.51 16.19
Mohsenizadeh52 2017 99 187 0.53 Delavari53 2011 1525 7.93 29.75
Etminan54 2019 355 507 0.10
Kermanshah & Khuzestan Karimi55 2016 2031 4.87 0.00
Kurdistan Maghsoudlu56 2018 198 136 0.29
Lorestan Abdi57 2008 1000 4.80
Markazi Mahdaviani58 2006 11 695 0.68 Sofian59 2010 529 11.15
Sofian59 2010 531 0.38
Razavi Khorasan Vossoughinia60 2010 314 154 1.16 Shahabi23 2009 5059 8.54 0.00
Yazhan61 2016 57 507 0.30
Hedayati-Moghaddam22 2019 58 276 0.39
Sistan-Baluchestan Sanei Moghaddam62 2005 7360 2.28 Sanei Moghaddam63 2010 431 20.19
Pazoukian15 2013 1500 9.60
Tehran Attarchi64 2006 26 811 0.62 Amini Kafiabad65 2007 2000 11.50 0.00
Khedmat66 2009 1 010 865 0.59 Vaezjalali24 2013 1000 8.00 50.00
Omidkhoda67 2011 11 510 0.47
Mirrezai68 2014 203 099 0.23
Mohammadali69 2014 2 034 497 0.39
Yazd Javadzadeh Shahshahani70 2013 255 427 0.26 Vaziri71 2021 1500 4.93 0.00

Discussion

The current study showed that 5.4% of HBsAg non-reactive BDs in northeastern Iran are anti-HBc-seroreactive. Most provinces of Iran were classified as areas with low levels of HBV endemicity, where 5–7% of the population have been exposed to the virus and up to 2% are chronic carriers.72 In a systematic review of 13 studies from 12 provinces of Iran,73 the national rates of HBs Ag and anti-HBc Ab among the general population were estimated at 1.8% (95% CI: 1.6%, 2.1%) and 13.6% (95% CI: 12.9%, 14.3%), respectively, with marked disparity across the provinces (0.8–5.1% for HBs Ag and 4.2–36.9% for anti-HBc Ab prevalence, respectively). The authors concluded that HBV prevalence in our country is low and has shown a declining trend over the past years; however, high HBV rates were reported in some provinces.

In 2009, Shahabi et al reported a rate of 8.5% anti-HBc seroreactivity among HBsAg non-reactive BDs in Mashhad. Compared to their report, our finding reflected a significant reduction in the rate of exposure to HBV during a ten-year period in this region.23 Our previous survey also showed a declining trend in the HBsAg positivity rate among BDs in northeastern Iran.22 Similarly, a declining trend of HBV infection among Iranian BDs has been shown in both low and high HBV prevalence regions over the past decades. Amini Kafi-abad et al74 reported that the overall HBsAg rates reduced from 1.8% in 1998 to 0.4% in 2007 in Iran. In the Fars province, an area with low HBV endemicity, the data declined from 0.9% to 0.3% during this period. Also, HBsAg frequency diminished from 3.7% to 1.1% in the Sistan-Baluchestan province, representing a high prevalence region. This trend could be due to improvements in donor recruitment and selection, as well as a reduction in HBV prevalence in the general population.

Our review indicated that anti-HBc prevalence differs among Iranian BDs based on different geographical regions (Table 3). Anti-HBc could be a serological marker of past or current exposure to HBV; therefore, its prevalence might be influenced by HBV endemicity levels in different regions. In a study by Merat et al,75 HBsAg prevalence rates among 18–65-year-old individuals chosen in 2006 from the general population in Tehran, Hormozgan, and Golestan provinces of Iran were assessed as 2.3%, 2.7%, and 5.1%, respectively. Correspondingly, the proportion of BDs with anti-HBc seropositivity in Tehran and Hormozgan were 14.2% and 13.3%, respectively, but the rate was reported as high as 36.9% in Golestan, a province with high HBV endemicity. Likewise, our literature review revealed that the highest frequency of anti-HBc (20.2%) was reported from the Sistan-Baluchestan province (Table 3),63 where a considerable rate of HBsAg seroreactivity (2.3%) was reported among BDs.62 Similarly, the prevalence of anti-HBc seropositivity varies among BDs in the countries of the world according to HBV prevalence among the general population, with rates of 0.2% in the USA,76 8.3% in Italy,77 10.2% in India,78 and 13.5% in South Korea.79 In a study in the Kurdistan Region of Iraq, 0.2% of 12 185 BDs were found to be HBsAg-positive, and only 2.3% of HBsAg-negative cases showed a reactive result for antibodies to HBV core antigen.80 Likewise, García-Montalvo et al reported a rate of 0.2% and 4.2% positivity for HBsAg and anti-HBc, respectively, among Mexican donors.81

We found that two-thirds of the donation samples negative for HBsAg but positive for anti-HBc- were also reactive for anti-HBs, and two-thirds of these (43% of all BDs) had a titer higher than 100 IU/L. Based on reports in the last decade, the rates of anti-HBs seroreactivity among anti-HBc positive BDs in different provinces of Iran were 72% to 85%.13,15,41,55,71,82 Similarly, some reports from Golestan and Sistan-Baluchestan, two provinces with the highest HBV frequency in the country, noticed that 46–48% of all HBsAg non-reactive and anti-HBc-positive donation volunteers had anti-HBs titer over 100 IU/L.13,15 However, higher rates (55–58%) were reported from other provinces, such as Yazd and Tehran.71,82 In developed countries such as Japan and the USA, up to 70% of people with anti-HBc positivity have anti-HBs titers above 100 IU/mL.83 In a study by Romanò et al, 86.7% of 2436 HBsAg-negative and anti-HBc-positive donors also had positive anti-HBs test results, of whom 63.9% revealed antibody titers > 100 IU/L.77 In contrast, the rate of anti-HBs positivity is much lower in low-income countries, where a high level of HBV endemicity is identified.83

By investigating the three S, C, or X genomic regions, we detected no OBI cases among BDs with or without anti-HBC positivity in northeast Iran. Likewise, Shahabi et al could not find any cases of occult hepatitis B among anti-HBC positive BDs in this area.23 Karimi et al55 tested the presence of the HBV genome in serum samples from HBsAg-negative BDs in two main blood centers in western and southwestern Iran. They could not detect any HBV DNA cases either using a PCR technique with pooled specimens of 5 donations among 1932 anti-HBc-negative cases or by a single specimen real-time assay among 99 samples positive for anti-HBc.

Our literature review indicated that the OBI rate among Iranian BDs varied from zero to 29.8% (Table 3). OBI prevalence in a specified population depends partly on HBV endemicity. Candotti et al84 reviewed OBI reports from Poland, Italy, Spain, and Germany and estimated only one to 51 OBI cases per 100 000 donations among the European countries with low HBV infection levels. Correspondingly, Romanò et al77 reported a low rate (0.33%) of HBV infection among Italian first-time BDs and identified only 12 cases (0.55%) with HBV DNA positivity among 2186 HBsAg-negative and anti-HBc-positive donors.

In some provinces of Iran, however, OBI percentages are not fully compatible with the prevalence of HBV infection. In provinces such as Fars and Isfahan, areas with low prevalence (0.37%–0.50%) of HBsAg seropositivity,29,32,44 considerable rates (11.6%–15.8%) of occult hepatitis B were reported.28,30,43 Conversely, no definite cases of circulating HBV DNA in serum were reported among BDs in Golestan, a province with a high HBV prevalence in the country.13,14 It has been suggested that variation in OBI rates could be related to factors other than HBV endemicity in particular geographical regions. These variables include the power of the studies, the distribution of HBV risk factors in communities, coverage rates of HBV vaccination, and the sensitivity of serological and/or molecular HBV detection assays.85 OBI prevalence could be overestimated when a less sensitive method was used to diagnose HBsAg in the serum samples.9 Besides, our previous meta-analysis showed that the rate of occult infection was significantly different in the Iranian population based on PCR techniques (conventional, nested, or real-time PCR) used to detect circulating HBV DNA in serum.16 The current study used the SYBR Green Real-Time PCR method to analyze three different HBV genomic regions (S, C, and X); all donors with or without anti-HBc tested negative for the three viral genes.10 These diverse results highlight the challenges in diagnosing OBI and emphasize the need to identify the target population for screening.

Our current study has some limitations. The accuracy of the homemade assay should be compared with an available standardized method. Another potential limitation could include variations in testing methods over time or the potential influence of factors not considered in the study.


Conclusion

Given the not-so-high prevalence (5.4%) of anti-HBc in HBsAg non-reactive BDs, it does not seem that routine screening for anti-HBc and excluding the cases with positive test results would reduce blood reserves in our region. Thus, anti-HBc testing could be added to the HBsAg test to screen all blood components to decrease the risk of post-transfusion HBV infection in Iran. On the other hand, we found that two-fifths of the anti-HBc-positive BDs had anti-HBs titer > 100 IU/L. We, therefore, suggest that an alternative strategy is designed to screen both anti-HBc and anti-HBs and to exclude only the population without a protective level of anti-HBs ( > 100 IU/L). Also, we do not propose using expensive molecular methods as a routine HBV screening tool since none of the BDs enrolled in our study, even those with anti-HBc seropositivity, had occult hepatitis.


Acknowledgements

We would like to thank the personnel of the Central Lab of ACECR, Razavi Khorasan Branch, Mashhad, Iran, for their kind technical assistance.


Competing Interests

The authors declare no conflicts of interest.

Ethical Approval

This work was approved by the ethics committee of ACECR, Razavi Khorasan Branch (Code: IR.ACECR.JDM.REC.1397.4), and informed consent was obtained from participants before their enrollment in the study.

Funding

This study was financially supported by the Research and Technology Deputy of the Academic Center for Education, Culture & Research (ACECR), Razavi Khorasan Branch, Mashhad, Iran [Grant: 97.48.1746].


References

  1. Almeida Neto C, Strauss E, Sabino EC, Sucupira MC, Chamone DA. Significance of isolated hepatitis B core antibody in blood donors from São Paulo. Rev Inst Med Trop Sao Paulo 2001; 43(4):203-8. doi: 10.1590/s0036-46652001000400005 [Crossref] [ Google Scholar]
  2. Jongerius JM, Wester M, Cuypers HT, van Oostendorp WR, Lelie PN, van der Poel CL. New hepatitis B virus mutant form in a blood donor that is undetectable in several hepatitis B surface antigen screening assays. Transfusion 1998; 38(1):56-9. doi: 10.1046/j.1537-2995.1998.38198141499.x [Crossref] [ Google Scholar]
  3. Allain JP, Cox L. Challenges in hepatitis B detection among blood donors. Curr Opin Hematol 2011; 18(6):461-6. doi: 10.1097/MOH.0b013e32834bac10 [Crossref] [ Google Scholar]
  4. Gerlich WH, Wagner FF, Chudy M, Harritshoj LH, Lattermann A, Wienzek S. HBsAg non-reactive HBV infection in blood donors: transmission and pathogenicity. J Med Virol 2007; 79(Suppl 1):S32-6. doi: 10.1002/jmv.20963 [Crossref] [ Google Scholar]
  5. Allain JP. Occult hepatitis B virus infection. Transfus Clin Biol 2004; 11(1):18-25. doi: 10.1016/j.tracli.2003.11.007 [Crossref] [ Google Scholar]
  6. Raimondo G, Allain JP, Brunetto MR, Buendia MA, Chen DS, Colombo M. Statements from the Taormina expert meeting on occult hepatitis B virus infection. J Hepatol 2008; 49(4):652-7. doi: 10.1016/j.jhep.2008.07.014 [Crossref] [ Google Scholar]
  7. Saitta C, Pollicino T, Raimondo G. Occult hepatitis B virus infection: an update. Viruses 2022; 14(7):1504. doi: 10.3390/v14071504 [Crossref] [ Google Scholar]
  8. Raimondo G, Locarnini S, Pollicino T, Levrero M, Zoulim F, Lok AS. Update of the statements on biology and clinical impact of occult hepatitis B virus infection. J Hepatol 2019; 71(2):397-408. doi: 10.1016/j.jhep.2019.03.034 [Crossref] [ Google Scholar]
  9. Esposito A, Sabia C, Iannone C, Nicoletti GF, Sommese L, Napoli C. Occult hepatitis infection in transfusion medicine: screening policy and assessment of current use of anti-HBc testing. Transfus Med Hemother 2017; 44(4):263-72. doi: 10.1159/000460301 [Crossref] [ Google Scholar]
  10. Zervou EK, Dalekos GN, Boumba DS, Tsianos EV. Value of anti-HBc screening of blood donors for prevention of HBV infection: results of a 3-year prospective study in northwestern Greece. Transfusion 2001; 41(5):652-8. doi: 10.1046/j.1537-2995.2001.41050652.x [Crossref] [ Google Scholar]
  11. Alavian SM, Jazayeri SM. Occult hepatitis B infection (OBI) in vaccinated groups, a metanalysis. Arch Med Lab Sci 2015; 1(2):74-83. doi: 10.22037/amls.v1i2.10296 [Crossref] [ Google Scholar]
  12. Kasraian L, Imanieh MH, Tabrizi R, Shahriarirad R, Erfani A, Hosseini S. Prevalence of HBV and HCV infections in Iranian blood donors; an updated systematic review and meta-analysis. Middle East J Dig Dis 2021; 13(3):237-52. doi: 10.34172/mejdd.2021.231 [Crossref] [ Google Scholar]
  13. Bahrami A, Pourfathollah AA, Parsania M, Mehrabi Habibabadi H, Sharifi Z. Prevalence of occult hepatitis B virus infection among the blood donors in Golestan province: cross-sectional study. Iran J Microbiol 2022; 14(3):410-6. doi: 10.18502/ijm.v14i3.9793 [Crossref] [ Google Scholar]
  14. Tabar Asad Laleh R, Sharifi Z, Pourfathollah AA, Samei S. Prevalence of occult hepatitis B infection among HBsAg negative blood donors in Golestan province. Int J Med Lab 2019; 6(1):63‐70. doi: 10.18502/ijml.v6i1.508 [Crossref] [ Google Scholar]
  15. Pazoukian M, Sharifi Z, Pourfatholah A, Hamidpour M, Sanei Moghaddam E, Khosravi S. Investigation of anti-HBc and anti-HBs prevalence in HBsAg negative blood donors in Sistan-Balutuestan province. Sci J Iran Blood Transfus Organ 2013;10(3):231-8. [Persian].
  16. Hedayati-Moghaddam MR, Soltanian H, Behzadifar M. Occult hepatitis B virus infection prevalence among different populations of Iran: a systematic review and meta-analysis. Hepat Mon 2020; 20(6):e101722. doi: 10.5812/hepatmon.101722 [Crossref] [ Google Scholar]
  17. Asli M, Kandelouei T, Rahimyan K, Davoodbeglou F, Vaezjalali M. Characterization of occult hepatitis B infection among injecting drug users in Tehran, Iran. Hepat Mon 2016; 16(3):e34763. doi: 10.5812/hepatmon.34763 [Crossref] [ Google Scholar]
  18. Mohraz M, Jafari R, Poortahmasebi V, Sadeghi A, Hajabdolbaghi M, Rasoolinejad M. Molecular analysis of occult hepatitis B infection among Iranian HIV-positive patients. Future Virol 2016; 11(7):497-508. doi: 10.2217/fvl-2016-0032 [Crossref] [ Google Scholar]
  19. Hashemi SJ, Hajiani E, Masjedizadeh A, Makvandi M, Shayesteh AA, Alavinejad SP. Occult hepatitis B infection in patients with cryptogenic liver cirrhosis in southwest of Iran. Jundishapur J Microbiol 2015; 8(3):e16873. doi: 10.5812/jjm.16873 [Crossref] [ Google Scholar]
  20. Keyvani H, Agah S, Kabir A, Alavian SM. Prevalence and risk factors of isolated anti-HBc antibody and occult hepatitis B infection in hemodialysis patients: a nationwide study. Ann Hepatol 2013; 12(2):213-9. [ Google Scholar]
  21. Fathimoghaddam F, Hedayati-Moghaddam MR, Bidkhori HR, Ahmadi S, Sima HR. The prevalence of hepatitis B antigen-positivity in the general population of Mashhad, Iran. Hepat Mon 2011; 11(5):346-50. [ Google Scholar]
  22. Hedayati-Moghaddam MR, Mollahosseini Foomani F, Gowhari Shabgah A. Frequency of viral transfusion-transmitted infections (TTIs) among resident and pilgrim blood donors in Mashhad, 2011. Int J Infect 2019; 6(2):e87350. doi: 10.5812/iji.87350 [Crossref] [ Google Scholar]
  23. Shahabi M, Sayadpour Zanjani D, Tabatabaee A, Khayami M, Shakibaei H, Bazargani R. Anti-HBc, viral markers and occult hepatitis B infection in blood donors of Mashhad. Iran J Infect Dis Trop Med 2009;14(44):21-5. [Persian].
  24. Vaezjalali M, Rashidpour S, Rezaee H, Hajibeigi B, Zeidi M, Gachkar L. Hepatitis B viral DNA among HBs antigen negative healthy blood donors. Hepat Mon 2013; 13(3):e6590. doi: 10.5812/hepatmon.6590 [Crossref] [ Google Scholar]
  25. Esmaieli H, Hajiani G, Mankhian A, Pourmahdi Borujeni M. Seroepidemiological survey of hepatitis B, C, HIV and syphilis among blood donors in Bushehr-Iran. Iran South Med J 2009;11(2):183-90. [Persian].
  26. Doosti A, Amini-Bavil-Olyaee S, Tajbakhsh E, Adeli A, Mahboudi F. Prevalence of viral hepatitis and molecular analysis of HBV among voluntary blood donors in west Iran. New Microbiol 2009; 32(2):193-8. [ Google Scholar]
  27. Ghavanini AA, Sabri MR. Hepatitis B surface antigen and anti-hepatitis C antibodies among blood donors in the Islamic Republic of Iran. East Mediterr Health J 2000; 6(5-6):1114-6. [ Google Scholar]
  28. Behzad-Behbahani A, Mafi-Nejad A, Tabei SZ, Bagheri Lankarani K, Torab A, Moaddeb A. Anti-HBc & HBV-DNA detection in blood donors negative for hepatitis B virus surface antigen in reducing risk of transfusion associated HBV infection. Indian J Med Res 2006; 123(1):37-42. [ Google Scholar]
  29. Emamghorashi F, Fathi G, Mohtashami A. Evaluation of demographic characteristics and hepatitis B, C and HIV prevalence among blood donors in Jahrom. Sci J Iran Blood Transfus Organ 2006;2(7):373-8. [Persian].
  30. Behzad-Behbahani A, Sabrfirozi M, Eghbali H, Nejabat N, Abbasfard Z, Amirzadeh S, et al. Hepatitis B virus DNA load and genetic characterization of HBsAg S-region isolated from Iranian blood donors with occult infection. The 4th International & 9th National Congress on Quality Improvement in Clinical Laboratories; 2011; Tehran, Iran.
  31. Kasraian L, Torab Jahromi SA. Prevalence of major transfusion-transmissible viral infections in blood donors attending Fars blood transfusion center, Shiraz, southern Iran: 2002-2005. Iran J Med Sci 2007; 32(2):114-7. [ Google Scholar]
  32. Kasraian L, Tavasoli A. Positivity of HIV, hepatitis B and hepatitis C in patients enrolled in a confidential self-exclusion system of blood donation: a cross-sectional analytical study. Sao Paulo Med J 2010; 128(6):320-3. doi: 10.1590/s1516-31802010000600002 [Crossref] [ Google Scholar]
  33. Kasraian L, Tavassoli A, Shayegan M, Alavian SM. The prevalence and risk factor of hepatitis B and D in Shiraz blood donors. Afr J Microbiol Res 2012; 6(18):3976-9. [ Google Scholar]
  34. Azadbakht M, Torabi Ardakani M, Delirakbariazar M, Kasraian L, Khaledi A, Foruozandeh H. Seroprevalence and trend of HBV, HCV, and HIV infections among blood donors of Fars province, Iran (2006-2018). Ethiop J Health Sci 2020; 30(3):397-408. doi: 10.4314/ejhs.v30i3.11 [Crossref] [ Google Scholar]
  35. Vahid T, Alavian SM, Kabir A, Kafaee J, Yektaparast B. Hepatitis B prevalence and risk factors in blood donors in Ghazvin, IR Iran. Hepat Mon 2005; 5(4):117-22. [ Google Scholar]
  36. Kazeminejad V, Azarhoush R, Mowlana A, Dehbashi G. Frequency of hepatitis B virus, hepatitis C virus and human immunodeficiency virus in blood donors and patients in Gorgan blood transfusion organization in 2003. J Gorgan Univ Med Sci 2005;7(1):84-6. [Persian].
  37. Bani Aghil SS, Abbasi S, Arab M, Seyedein MS. The prevalence of HCV, HBV, HIV in blood donors of Golestan province, (2006-2008). Med Lab J 2009;3(2):1-5. [Persian].
  38. Mansour Ghanaei F, Fallah MS, Jafarshad R, Joukar F, Salari A, Tavafzadeh R, et al. Prevalence of hepatitis B and hepatitis C, and their risk factors among Guilan blood donors. Sci J Iran Blood Transfus Organ 2008;4(5):331-6. [Persian].
  39. Khamesipour A, Mohtasham Amiri Z, Amini Kafiabad S, Saadat F, Mansour Ghanaei F, Esteghamati AR. Frequency of hepatitis B virus DNA in anti-HBc positive, HBsAg negative blood donors in Rasht, northern Iran. Transfus Apher Sci 2011; 45(2):195-7. doi: 10.1016/j.transci.2011.08.005 [Crossref] [ Google Scholar]
  40. Taheri Azbarmi Z, Nouri S, Joukar F, Jafarshad R, Haajikarimian K, Alinejad S, et al. Transfusion transmitted diseases in Rasht blood donors. Sci J Iran Blood Transfus Organ 2008;4(5):337-43. [Persian].
  41. Khorami F, Sobhani SA, Davoudian P, Khajeh E. Prevalence of HBc-Ab among HBs-Ag negative healthy blood donors in south of Iran. Electron Physician 2013; 5(3):659-63. doi: 10.14661/2013.659-663 [Crossref] [ Google Scholar]
  42. Afzali H, Taghavi Ardakani A, Vali GR. Seroepidemiology of hepatitis B and C in blood donors in Kashan, 1996-2001. Feyz 2002;6(3):43-50. [Persian].
  43. Pourazar A, Salehi M, Jafarzadeh A, Kazemi Arababadi M, Oreizi F, Shariatinezhad K. Detection of HBV DNA in HBsAg negative normal blood donors. Iran J Immunol 2005; 2(3):172-6. [ Google Scholar]
  44. Moniri R, Mosayebii Z, Mossavi GA. Seroprevalence of cytomegalovirus, hepatitis B, hepatitis C and human immunodeficiency virus antibodies among volunteer blood donors. Iran J Public Health 2004; 33(4):38-42. [ Google Scholar]
  45. Masaeli Z, Jaberi MR, Magsudlu M. A comparison of seroprevalence of blood-borne infections among regular, sporadic, and first-time blood donors in Isfahan. Sci J Iran Blood Transfus Organ 2006;2(7):301-7. [Persian].
  46. Pourazar A, Akbari N, Hariri MM, Yavari F, Akbari SH. Evaluation of demographic profiles and prevalence of major viral markers in first time vs repeat blood donors in Esfahan. Sci J Iran Blood Transfus Organ 2006;2(7):323-9. [Persian].
  47. Ebrahimian Z, Fazilati M, Akbari N, Hariri MM, Fatehi Far MR. Correlation of deferral rate with the frequency rate of viral markers of HBV, HCV and HIV in blood supplies during 2004 to 2009. Sci J Iran Blood Transfus Organ 2011;8(2):130-6. [Persian].
  48. Arab M, Abas Zadeh A, Pourabuli B, Soleimanizadeh L, Shahsavari M, Javadi M. Prevalence of HBsAg positivity in blood donors in Bam, 1999-2002. Sci J Iran Blood Transfus Organ 2006; 3(3):277-80. [ Google Scholar]
  49. Jafarzadeh A, Kazemi Arababadi M, Mirzaee M, Pourazar A. Occult hepatitis B virus infection among blood donors with antibodies to hepatitis B core antigen. Acta Med Iran 2008; 46(1):27-32. [ Google Scholar]
  50. Seyed-Askari SM, Beigzadeh A, Mohammadpoor-Ravari M. The prevalence of transfusion transmitted infections among blood donors in Kerman, Iran. J Kerman Univ Med Sci 2015;22(5):669-76. [Persian].
  51. Kazemi Arababadi M, Pourfathollah AA, Jafarzadeh A, Hassanshahi G, Afrooz MR, Hadadian M. Occult HBV infection in Rafsanjanese blood donors. Pathobiol Res 2009;11(3):81-6. [Persian].
  52. Mohsenizadeh M, Mollaei HR, Ghaziizadeh M. Seroepidemiological study of hepatitis B, C and HIV among blood donors in Kerman. Asian Pac J Cancer Prev 2017; 18(12):3267-72. doi: 10.22034/apjcp.2017.18.12.3267 [Crossref] [ Google Scholar]
  53. Delvari M, Shahabinejhad N, Renzaho A, Zahedi M, Owhadi AR. Frequency of anti-HBc & HBV DNA detection in blood donors of Kerman province, Iran. J Blood Disord Transfus 2011; 2(1):105. doi: 10.4172/2155-9864.1000105 [Crossref] [ Google Scholar]
  54. Etminan A, Naghibzadeh-Tahami A, Seyed-Askari SM. The association between the prevalence of transfusion transmitted infections and characteristics of infected blood donors in Kerman, Iran. J Kerman Univ Med Sci 2019; 26(5):377-83. doi: 10.22062/jkmu.2019.89545.[Persian] [Crossref] [ Google Scholar]
  55. Karimi G, Zadsar M, Vafaei N, Sharifi Z, Falah Tafti M. Prevalence of antibody to hepatitis B core antigen and hepatitis B virus DNA in HBsAg negative healthy blood donors. Virol J 2016; 13:36. doi: 10.1186/s12985-016-0492-8 [Crossref] [ Google Scholar]
  56. Maghsoudlu M, Salehifar P, Rahimzadeh P, Babahajian W, Mohammadi S, Babahajian S, et al. Prevalence and trends of transfusion-transmissible infections and study of confidential unit exclusion among blood donors in Kurdistan province of Iran. Int J Med Lab 2018;5(1):58-65. [Persian].
  57. Abdi J, Moazami Goodarzi HR. Prevalence of HBcAb among the HBsAg negative first-time blood donors in Khorramabad and Borujerd blood centers. Sci J Iran Blood Transfus Organ 2008;4(5):323-9. [Persian].
  58. Mahdaviani F, Saremi S, Maghsoudlu M, Pourfathollah AA. Prevalence of blood transmitted viral infections in regular and non-regular donors of Arak blood center. Sci J Iran Blood Transfus Organ 2006;2(7):343-51. [Persian].
  59. Sofian M, Aghakhani A, Izadi N, Banifazl M, Kalantar E, Eslamifar A. Lack of occult hepatitis B virus infection among blood donors with isolated hepatitis B core antibody living in an HBV low prevalence region of Iran. Int J Infect Dis 2010; 14(4):e308-10. doi: 10.1016/j.ijid.2009.05.011 [Crossref] [ Google Scholar]
  60. Vossoughinia H, Shakeri MT, Mokhtari Amirmajdi E, Ravanbakhsh F, Abedini S. Risk factors for hepatitis B and C in 400 blood donor volunteers in Mashhad during 2003-2007: a case-control study. Intern Med Today 2010;15(4):68-75. [Persian].
  61. Yazhan S, Sohrabi E, Jamili P, Saffari SE, Shafie Mojaddadi M. Frequency of HBV, HCV and HIV infections among Sabzevar blood donors based on demographic characteristics during 2009-2013. Sci J Iran Blood Transfus Organ 2016;13(3):197-206. [Persian].
  62. Sanei Moghaddam E, Khosravi S, Gharibi T. Prevalence of HBsAg and anti-HCV reactivity in donors embarking on direct blood donation and among first-time blood donors in Zahedan Blood Transfusion Center. Sci J Iran Blood Transfus Organ 2005;1(2):19-26. [Persian].
  63. Sanei Moghaddam E, Khosravi S, Ghorbani GA, Alavian SM. Hepatitis B core antibody in blood donor in Sistan-Balutuestan province of Iran. Indian J Med Sci 2010; 64(9):391-5. [ Google Scholar]
  64. Attarchi Z, Ghafouri M, Hajibeigi B, Assari SH, Alavian SM. Donor deferral and blood-borne infections in blood donors of Tehran. Sci J Iran Blood Transfus Organ 2006;2(7):353-64. [Persian].
  65. Amini Kafi-Abad S, Talebian A, Moghtadaie M, Ranjbar Kermani F, Ferdowsian F, Samie SH, et al. Detection of hepatitis B virus DNA (PCR) in HBsAg negative, anti-HBc positive blood donors in Tehran province. Sci J Iran Blood Transfus Organ 2007;3(5):387-79. [Persian].
  66. Khedmat H, Alavian SM, Miri SM, Amini M, Abolghasemi H, Hajibeigi B, et al. Trends in Seroprevalence of Hepatitis B, Hepatitis C, HIV, and Syphilis Infections in Iranian Blood Donors from 2003 to 2005. Hepat Mon.9(1):24-8.
  67. Omidkhoda A, Gharehbaghian A, Jamali M, Ahmadbeigi N, Hashemi SM, Rahimi A. Comparison of the prevalence of major transfusion-transmitted infections among Iranian blood donors using confidential unit exclusion in an Iranian population: transfusion-transmitted infections among Iranian blood donors. Hepat Mon 2011; 11(1):11-3. [ Google Scholar]
  68. Mirrezaie SM, Saber HR, Hajibeigi B, Salekmoghaddam E, Abbasian A, Alavian SM. Impact of HBV vaccination on prevalence of hepatitis B virus infection among volunteer blood donors in Tehran-Iran. Shiraz E Med J 2014; 15(2):e18066. doi: 10.17795/semj18066 [Crossref] [ Google Scholar]
  69. Mohammadali F, Pourfathollah AA. Changes in frequency of HBV, HCV, HIV and syphilis infections among blood donors in Tehran province 2005-2011. Arch Iran Med 2014; 17(9):613-20. [ Google Scholar]
  70. Javadzadeh Shahshahani H, Vaziri M, Mansouri F. Seven years trends in prevalence of transfusion-transmissible viral infections in Yazd blood transfusion organization. Iran J Ped Hematol Oncol 2013; 3(3):119-24. [ Google Scholar]
  71. Vaziri M, Javadzadeh Shahshahani H. Frequency of hepatitis B virus-DNA among hepatitis B surface-Ag negative, anti-hepatitis B core antibody-positive blood donors in Yazd, Iran. Asian J Transfus Sci 2021; 15(2):179-82. doi: 10.4103/ajts.AJTS_155_18 [Crossref] [ Google Scholar]
  72. Ott JJ, Stevens GA, Groeger J, Wiersma ST. Global epidemiology of hepatitis B virus infection: new estimates of age-specific HBsAg seroprevalence and endemicity. Vaccine 2012; 30(12):2212-9. doi: 10.1016/j.vaccine.2011.12.116 [Crossref] [ Google Scholar]
  73. Hajarizadeh B, Mesgarpour B, Nasiri MJ, Alavian SM, Merat S, Poustchi H. Estimating the prevalence of hepatitis B virus infection and exposure among general population in Iran. Hepat Mon 2017; 17(8):e11715. doi: 10.5812/hepatmon.11715 [Crossref] [ Google Scholar]
  74. Amini Kafi-Abad S, Rezvan H, Abolghasemi H. Trends in prevalence of hepatitis B virus infection among Iranian blood donors, 1998-2007. Transfus Med 2009; 19(4):189-94. doi: 10.1111/j.1365-3148.2009.00935.x [Crossref] [ Google Scholar]
  75. Merat S, Rezvan H, Nouraie M, Jamali A, Assari S, Abolghasemi H. The prevalence of hepatitis B surface antigen and anti-hepatitis B core antibody in Iran: a population-based study. Arch Iran Med 2009; 12(3):225-31. [ Google Scholar]
  76. Stramer SL, Zou S, Notari EP, Foster GA, Krysztof DE, Musavi F. Blood donation screening for hepatitis B virus markers in the era of nucleic acid testing: are all tests of value?. Transfusion 2012; 52(2):440-6. doi: 10.1111/j.1537-2995.2011.03283.x [Crossref] [ Google Scholar]
  77. Romanò L, Velati C, Cambiè G, Fomiatti L, Galli C, Zanetti AR. Hepatitis B virus infection among first-time blood donors in Italy: prevalence and correlates between serological patterns and occult infection. Blood Transfus 2013; 11(2):281-8. doi: 10.2450/2012.0160-12 [Crossref] [ Google Scholar]
  78. Makroo RN, Chowdhry M, Bhatia A, Arora B, Rosamma NL. Hepatitis B core antibody testing in Indian blood donors: a double-edged sword!. Asian J Transfus Sci 2012; 6(1):10-3. doi: 10.4103/0973-6247.95043 [Crossref] [ Google Scholar]
  79. Seo DH, Whang DH, Song EY, Kim HS, Park Q. Prevalence of antibodies to hepatitis B core antigen and occult hepatitis B virus infections in Korean blood donors. Transfusion 2011; 51(8):1840-6. doi: 10.1111/j.1537-2995.2010.03056.x [Crossref] [ Google Scholar]
  80. Hassan RN, Hussain AH. Hepatitis B virus DNA in blood donors positive of anti-hepatitis B core antibodies and negative for surface antigen in Hawler major blood bank, Kurdistan region, Iraq. J Fac Med Baghdad 2018; 60(1):57-61. doi: 10.32007/jfacmedbagdad.60146 [Crossref] [ Google Scholar]
  81. García-Montalvo BM, Farfán-Ale JA, Acosta-Viana KY, Puerto-Manzano FI. Hepatitis B virus DNA in blood donors with anti-HBc as a possible indicator of active hepatitis B virus infection in Yucatan, Mexico. Transfus Med 2005; 15(5):371-8. doi: 10.1111/j.1365-3148.2005.00610.x [Crossref] [ Google Scholar]
  82. Alizadeh Z, Milani S, Sharifi Z. Occult hepatitis B virus infection among Iranian blood donors: a preliminary study. Arch Iran Med 2014; 17(2):106-7. [ Google Scholar]
  83. Candotti D, Laperche S. Hepatitis B virus blood screening: need for reappraisal of blood safety measures?. Front Med (Lausanne) 2018; 5:29. doi: 10.3389/fmed.2018.00029 [Crossref] [ Google Scholar]
  84. Candotti D, Grabarczyk P, Ghiazza P, Roig R, Casamitjana N, Iudicone P. Characterization of occult hepatitis B virus from blood donors carrying genotype A2 or genotype D strains. J Hepatol 2008; 49(4):537-47. doi: 10.1016/j.jhep.2008.04.017 [Crossref] [ Google Scholar]
  85. Ji DZ, Pang XY, Shen DT, Liu SN, Goyal H, Xu HG. Global prevalence of occult hepatitis B: a systematic review and meta-analysis. J Viral Hepat 2022; 29(5):317-29. doi: 10.1111/jvh.13660 [Crossref] [ Google Scholar]

Submitted: 29 Nov 2023
Accepted: 11 Mar 2024
First published online: 27 Apr 2024
EndNote EndNote

(Enw Format - Win & Mac)

BibTeX BibTeX

(Bib Format - Win & Mac)

Bookends Bookends

(Ris Format - Mac only)

EasyBib EasyBib

(Ris Format - Win & Mac)

Medlars Medlars

(Txt Format - Win & Mac)

Mendeley Web Mendeley Web
Mendeley Mendeley

(Ris Format - Win & Mac)

Papers Papers

(Ris Format - Win & Mac)

ProCite ProCite

(Ris Format - Win & Mac)

Reference Manager Reference Manager

(Ris Format - Win only)

Refworks Refworks

(Refworks Format - Win & Mac)

Zotero Zotero

(Ris Format - FireFox Plugin)

Abstract View: 247149
PDF Download: 232834
Full Text View: 80376